
convert paired-end SAM to fastq using a memory buffer.
| Use samtools collate | samtools fastq |
Usage: java -jar dist/bam2fastq.jar [options] Files
Usage: bam2fastq [options] Files
Options:
-d, --distance
put the reads in memory if they're lying within that distance. A
distance specified as a positive integer.Commas are removed. The
following suffixes are interpreted : b,bp,k,kb,m,mb,g,gb
Default: 5000
-R1, --forward
Save fastq_R1 to file (default: stdout)
-h, --help
print help and exit
--helpFormat
What kind of help. One of [usage,markdown,xml].
--maxRecordsInRam
When writing files that need to be sorted, this will specify the number
of records stored in RAM before spilling to disk. Increasing this number
reduces the number of file handles needed to sort a file, and increases
the amount of RAM needed
Default: 50000
-R, --reference
Indexed fasta Reference file. This file must be indexed with samtools
faidx and with picard/gatk CreateSequenceDictionary or samtools dict
--regions
Limit analysis to this interval. A source of intervals. The following
suffixes are recognized: vcf, vcf.gz bed, bed.gz, gtf, gff, gff.gz,
gtf.gz.Otherwise it could be an empty string (no interval) or a list of
plain interval separated by '[ \t\n;,]'
-R2, --reverse
Save fastq_R2 to file (default: interlaced with forward)
-R0, --single
Save single-end to this file. If unspecified, single-end reads are
ignored.
--tmpDir
tmp working directory. Default: java.io.tmpDir
Default: []
-U1, --unpaired-forward
Save unresolved forward pair to file. If unspecified, unresolved reads
are ignored.
-U2, --unpaired-reverse
Save unresolved forward pair to file. If unspecified, unresolved reads
are ignored.
--validation-stringency
SAM Reader Validation Stringency
Default: LENIENT
Possible Values: [STRICT, LENIENT, SILENT]
--version
print version and exit
${PATH}. Setting JAVA_HOME is not enough : (e.g: https://github.com/lindenb/jvarkit/issues/23 )$ git clone --recurse-submodules "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew bam2fastq
The java jar file will be installed in the dist directory.
20131120
The project is licensed under the MIT license.
Should you cite bam2fastq ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md
The current reference is:
http://dx.doi.org/10.6084/m9.figshare.1425030
Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030
use
samtools collate | samtools fastq
$ java -jar dist/bam2fastq.jar src/test/resources/S2.bam | head -n 16
@RF01_38_466_2:0:0_3:0:0_8f
TCTAGTCAGAATATTTATCATTTATATATAACTCACAATCCGCATTTCAAATTCCAATATACTATTCTTC
+
2222222222222222222222222222222222222222222222222222222222222222222222
@RF01_38_466_2:0:0_3:0:0_8f
CCAACCAGAACATAACTGCATTTAAATTTGATGATAATTAAGTTAAACTTGCTGGATCCATCAATTAATC
+
2222222222222222222222222222222222222222222222222222222222222222222222
@RF01_20_472_1:0:0_3:0:0_32
GTTTTACCCACCAGAACATAACTGCATTTAAATTTGATGATAATGAAGTTAAAATTGCTGGCTCCATCAA
+
2222222222222222222222222222222222222222222222222222222222222222222222
@RF01_20_472_1:0:0_3:0:0_32
TGGGGAAGTATAATCTAATCTTGTCAGAATATTTATCATTTATATATAACTCACAATCCGCAGTTCAACT
+
2222222222222222222222222222222222222222222222222222222222222222222222