jvarkit

SortSamRefName

Last commit

Sort a BAM on chromosome/contig and then on read/querty name

Usage

Usage: java -jar dist/sortsamrefname.jar  [options] Files
Usage: sortsamrefname [options] Files
  Options:
    --bamcompression
      Compression Level. 0: no compression. 9: max compression;
      Default: 5
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
    --maxRecordsInRam
      When writing  files that need to be sorted, this will specify the number 
      of records stored in RAM before spilling to disk. Increasing this number 
      reduces the number of file  handles needed to sort a file, and increases 
      the amount of RAM needed
      Default: 50000
    -o, --out
      Output file. Optional . Default: stdout
    -R, --reference
      Indexed fasta Reference file. This file must be indexed with samtools 
      faidx and with picard CreateSequenceDictionary
    --regions
      Limit analysis to this interval. A source of intervals. The following 
      suffixes are recognized: vcf, vcf.gz bed, bed.gz, gtf, gff, gff.gz, 
      gtf.gz.Otherwise it could be an empty string (no interval) or a list of 
      plain interval separated by '[ \t\n;,]'
    --samoutputformat
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
    --tmpDir
      tmp working directory. Default: java.io.tmpDir
      Default: []
    --validation-stringency
      SAM Reader Validation Stringency
      Default: LENIENT
      Possible Values: [STRICT, LENIENT, SILENT]
    --version
      print version and exit

Keywords

See also in Biostars

Compilation

Requirements / Dependencies

Download and Compile

$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew sortsamrefname

The java jar file will be installed in the dist directory.

Creation Date

20150812

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/misc/SortSamRefName.java

Unit Tests

https://github.com/lindenb/jvarkit/tree/master/src/test/java/com/github/lindenb/jvarkit/tools/misc/SortSamRefNameTest.java

Contribute

License

The project is licensed under the MIT license.

Citing

Should you cite sortsamrefname ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

Example

$  java -jar dist/sortsamrefname.jar /commun/data/packages/samtools/1.2/samtools/examples/toy.sam  2> /dev/null 
@HD	VN:1.4	SO:unsorted
@SQ	SN:ref	LN:45
@SQ	SN:ref2	LN:40
@CO	SortSamRefName 1c7bc5e674136947586779a2aac53e576db4a67f /commun/data/packages/samtools/1.2/samtools/examples/toy.sam
r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
x1	0	ref2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	????????????????????
x2	0	ref2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????
x3	0	ref2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????
x4	0	ref2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????
x5	0	ref2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????
x6	0	ref2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????