jvarkit

BamWithoutBai

Last commit

Query a Remote BAM without bai

Usage

Usage: bamwithoutbai [options] Files
  Options:
    --bamcompression
      Compression Level.
      Default: 5
    --debug
      Enable debugging information.
      Default: false
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
  * -r, --region, --interval
      An interval as the following syntax : "chrom:start-end" or 
      "chrom:middle+extend"  or "chrom:start-end+extend" or 
      "chrom:start-end+extend-percent%".A program might use a Reference 
      sequence to fix the chromosome name (e.g: 1->chr1)
      Default: <empty string>
    -o, --output
      Output file. Optional . Default: stdout
    --reference, -R
      For writing CRAM. Indexed fasta Reference file. This file must be 
      indexed with samtools faidx and with picard CreateSequenceDictionary
    --samoutputformat
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
    --version
      print version and exit

Keywords

Compilation

Requirements / Dependencies

Download and Compile

$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew bamwithoutbai

The java jar file will be installed in the dist directory.

Creation Date

20191213

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/nobai/BamWithoutBai.java

Unit Tests

https://github.com/lindenb/jvarkit/tree/master/src/test/java/com/github/lindenb/jvarkit/tools/nobai/BamWithoutBaiTest.java

Contribute

License

The project is licensed under the MIT license.

Citing

Should you cite bamwithoutbai ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

Motivation

this tool queries a remote bam without bai (e.g: Encode bams - last checked 2019-12-16)

The idea is to run a binary search on the remote BAM, scanning for the BGZF blocks and the Bam Record.

This tool uses a class from the https://github.com/disq-bio/disq project , written by Tom White, originally from the Hadoop-BAM project.

This tool expect ‘small’ reads. Long reads may fail.

Acknowledgement

Louis Bergelson and John Marshall for their useful suggestions

Example

$ java  -jar dist/bamwithoutbai.jar  -r "chr3:38548061-38649667" \
   -o jeter.bam https://www.encodeproject.org/files/ENCFF741DEO/@@download/ENCFF741DEO.bam

$ samtools view jeter.bam
D2FC08P1:268:C3NPCACXX:8:1111:11204:70951	99	chr3	38548254	255	1S99M1S	=	38548442	289	CCACCTCCCACCCCCAACCACACCGTCTGCAGCCAGCCCCAGGCACCTGTCTCAAAGCTCCCGGGCTGTCCACACACACAAAAACCACAGTCTCCTTCCGC	@@@FFFFFFHHGHJIGIIJJIJJIGIIJGHGGHIIHHIIJJJGIIJJDGCHGHHHFEDFFFDCBDDBBBCDDDDDDDDDDB?BBDDBD@?>CCCCC@CC##	NH:i:1	HI:i:1	AS:i:198	NM:i:0	MD:Z:99
D2FC08P1:268:C3NPCACXX:8:1216:18650:7210	99	chr3	38548254	255	1S100M	=	38548442	289	CCACCTCCCACCCCCAACCACACCGTCTGCAGCCAGCCCCAGGCACCTGTCTCAAAGCTCCCGGGCTGTCCACACACACAAAAACCACAGTCTCCTTCCGG	CCCFFFFFHHHDHIJJJJJJIJJJJHHIJIJIJIJIIJIGIIJIIJJJJHHGHFHFFFFFFDDDBDDBBDCDDDDDDBBDDBDDDDDDDDCDDDDDDDD##	NH:i:1	HI:i:1	AS:i:199	NM:i:0	MD:Z:100
(...)
D2FC08P1:268:C3NPCACXX:8:1303:15665:9279	147	chr3	38649573	255	101M	=	38633218	-16456	TTGGCGCGGACTCGGCTCGGCGCGGGGCTCGGGGCACTGGGCGCAGGCTCAGCGGCCCCGGGGGAGCGATCCCTGCATCCTACGGGCGCCGCCGCCGTCTC	<9DDBB@C<2BB@DBDDBDBDDDDDBDB9BDDDDDCDDDDDDDDDDDDDDDDDDDDDDBDDDDDBBBDDDDDDDDDDDDDDBDDDDFJHHHHHFFFFFCCC	NH:i:1	HI:i:1	AS:i:196	NM:i:0	MD:Z:101
D2FC08P1:268:C3NPCACXX:8:2312:16447:12679	147	chr3	38649596	255	23S78M	=	38633222	-16452	GGGGCGGGGCCCGGGGGGGGGGGGGGGCGGGGGGCGCGGGGCGCAGCCTCGGCGCCCCGGGGGGAGCGATCCCTGCATCCTACGGGCGCCGCCGCCGTCTC	###################################################################################B>6<6F?DFFDDDDD@@@	NH:i:1	HI:i:1	AS:i:155	NM:i:8	MD:Z:5T0C5A1T8G3A3G3C42

comparing wget+samtools vs bamwithoutbai :

$ cat interval.bed
chr22	41697506	41756151

$ time wget -q -O - "https://www.encodeproject.org/files/ENCFF741DEO/@@download/ENCFF741DEO.bam" |\
	samtools view -L interval.bed -O BAM -owget.bam - 

real	17m48,710s
user	8m7,346s
sys	0m51,719s


$ samtools view wget.bam | sha1sum 
5fc261d051592edd791309211727ebbd0e3de909  -

time java -jar dist/bamwithoutbai.jar  -o nobai.bam -r "chr22:41697507-41756151" \
	 'https://www.encodeproject.org/files/ENCFF741DEO/@@download/ENCFF741DEO.bam' 

real	0m24,848s
user	0m3,860s
sys	0m0,320s

$ samtools view nobai.bam | sha1sum 
5fc261d051592edd791309211727ebbd0e3de909  -

Working behind a proxy.

see https://docs.oracle.com/javase/8/docs/technotes/guides/net/proxies.html

$ java -Dhttp.proxyHost=webcache.example.com  -Dhttp.proxyPort=1234 \
    -Dhttps.proxyHost=webcache.example.com  -Dhttps.proxyPort=1234 \
    -jar dist/bamwithoutbai.jar  -r "chr3:38548061-38649667" \
   -o jeter.bam https://www.encodeproject.org/files/ENCFF741DEO/@@download/ENCFF741DEO.bam

Screenshot

https://twitter.com/yokofakun/status/1207337424935936001

https://twitter.com/yokofakun/status/1207337424935936001

See also