jvarkit

Biostar170742

Last commit

convert sam format to axt Format

Usage

Usage: biostar170742 [options] Files
  Options:
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
    -o, --output
      Output file. Optional . Default: stdout
  * -R, --reference
      Indexed fasta Reference file. This file must be indexed with samtools 
      faidx and with picard CreateSequenceDictionary
    --version
      print version and exit

Keywords

See also in Biostars

Compilation

Requirements / Dependencies

Download and Compile

$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew biostar170742

The java jar file will be installed in the dist directory.

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/biostar/Biostar170742.java

Contribute

License

The project is licensed under the MIT license.

Citing

Should you cite biostar170742 ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

Example

$ java -jar dist-2.0.1/biostar170742.jar \
	-R ref.fa \
	S1.bam  | head -n 15
 
0 rotavirus 1 70 rotavirus_1_317_5:0:0_7:0:0_2de/1 + 60
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGCAGATGGTAAGCTCTATTATT
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAATATGGCGTCAACTCAGCAGATGGTCAGCTCTAATATT

1 rotavirus 1 70 rotavirus_1_535_4:0:0_4:0:0_1a6/2 + 60
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGCAGATGGTAAGCTCTATTATT
GGCTTTTACTGCTTTTCAGTGGTTGCTTCTCAAGATGGAGTGTACTCATCAGATGGTAAGCTCTATTATT

2 rotavirus 1 70 rotavirus_1_543_5:0:0_11:0:0_390/2 + 60
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGCAGATGGTAAGCTCTATTATT
GGCTTTTAATGCTTTTCATTTGATGCTGCTCAAGATGGAGTCTACACAGCAGATGGTCAGCTCTATTATT

3 rotavirus 1 70 rotavirus_1_578_3:0:0_7:0:0_7c/1 + 60
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTACTCAGCAGATGGTAAGCTCTATTATT
GGCTTTTAATGCTTTTCAGTGGTTGCTGCTCAAGATGGAGTCTCCTGAGCAGCTGGTAAGCTCTATTATT
(...)