
Extract PE Reads (with their mates) supporting variants in vcf file
This program is now part of the main jvarkit tool. See jvarkit for compiling.
Usage: java -jar dist/jvarkit.jar biostar322664 [options] Files
Usage: biostar322664 [options] Files
Options:
-all, --all
used in complement of option -X . Will output any SamRecord, but some
reads will carrying the information about the variant in a 'Xx'
attribute.
Default: false
--bamcompression
Compression Level. 0: no compression. 9: max compression;
Default: 5
-h, --help
print help and exit
--helpFormat
What kind of help. One of [usage,markdown,xml].
-index, --index
Use the VCF input to query the BAM using bai index. Faster for large bam
+ small VCF. Require option `--no-mate` and the bam file to be indexed.
Default: false
-nm, --no-mate
Disable the 'mate' function. BAM is not expected to be sorted with
picard , the bam can be sorted on coordinate, but mate will not be
found/written.
Default: false
-o, --output
Output file. Optional . Default: stdout
-pair, --pair, --both
pair mode: the paired read and each read of the pair (R1 and R2) must
BOTH carry at least one variant
Default: false
-R, --reference
For reading/writing CRAM files. Indexed fasta Reference file. This file
must be indexed with samtools faidx and with picard/gatk
CreateSequenceDictionary or samtools dict
--samoutputformat
Sam output format.
Default: SAM
Possible Values: [BAM, SAM, CRAM]
* -V, --variant
Variant VCF file. This tool **doesn't work** with INDEL/SV.
--version
print version and exit
-x, -X
If defined, add the variant(s) information in a 'X' metadata. One
character only.
20180625
The project is licensed under the MIT license.
Should you cite biostar322664 ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md
The current reference is:
http://dx.doi.org/10.6084/m9.figshare.1425030
Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030
##Example
$ java -jar picard.jar SortSam I=src/test/resources/S1.bam O=query.bam SO=queryname
$ java -jar dist/biostar322664.jar -V src/test/resources/S1.vcf.gz query.bam
RF02_358_926_2:0:0_2:1:0_83 83 RF02 857 60 70M = 358 -569 GACGTGAACTATATAATTAAAATGGACAGAAATCTGCCATCAACAGCTAGATATATAAGACCTAATTTAC 2222222222222222222222222222222222222222222222222222222222222222222222 RG:Z:S1 NM:i:3 AS:i:55 XS:i:0
RF02_362_917_2:0:0_2:1:0_6f 147 RF02 848 60 70M = 362 -556 ATAAGGAATCACGTTAACTATATACTTAAAATGGACTGAAATCTGCCATCAACAGCTAGATATATAAGAC 2222222222222222222222222222222222222222222222222222222222222222222222 RG:Z:S1 NM:i:3 AS:i:55 XS:i:0
(...)
$ java -jar dist/biostar322664.jar -nm -index -V src/test/resources/S1.vcf.gz src/test/resources/S1.bam
(...)
RF02_827_1385_4:1:0_2:0:0_3f 163 RF02 827 60 70M = 1316 559 ATCAATTACATTCCTGAAAGGATAAGGAATGAGGTTAACTATCTACTTAAAATGGACAGAAATCTGCCAA 2222222222222222222222222222222222222222222222222222222222222222222222 RG:Z:S1 NM:i:5 AS:i:53XS:i:0
RF02_827_1292_4:0:0_1:0:0_50 163 RF02 827 60 70M = 1223 466 TTCAATTACATTCCTGCAAGGATAAGGAATGCCGTTAACTATATACTTAATAAGGACAGAAATCTGGCAT 2222222222222222222222222222222222222222222222222222222222222222222222 RG:Z:S1 NM:i:4 AS:i:51XS:i:0
(...)