jvarkit

Biostar322664

Extract PE Reads (with their mates) supporting variants in vcf file

Usage

This program is now part of the main jvarkit tool. See jvarkit for compiling.

Usage: java -jar dist/jvarkit.jar biostar322664  [options] Files

Usage: biostar322664 [options] Files
  Options:
    -all, --all
      used in complement of option -X . Will output any SamRecord, but some 
      reads will carrying the information about the variant in a 'Xx' 
      attribute. 
      Default: false
    --bamcompression
      Compression Level. 0: no compression. 9: max compression;
      Default: 5
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
    -index, --index
      Use the VCF input to query the BAM using bai index. Faster for large bam 
      + small VCF. Require option `--no-mate` and the bam file to be indexed.
      Default: false
    -nm, --no-mate
      Disable the 'mate' function. BAM is not expected to be sorted with 
      picard , the bam can be sorted on coordinate, but mate will not be 
      found/written. 
      Default: false
    -o, --output
      Output file. Optional . Default: stdout
    -pair, --pair, --both
      pair mode: the paired read and each read of the pair (R1 and R2) must  
      BOTH carry at least one variant
      Default: false
    -R, --reference
      For reading/writing CRAM files. Indexed fasta Reference file. This file 
      must be indexed with samtools faidx and with picard/gatk 
      CreateSequenceDictionary or samtools dict
    --samoutputformat
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
  * -V, --variant
      Variant VCF file. This tool **doesn't work** with INDEL/SV.
    --version
      print version and exit
    -x, -X
      If defined, add the variant(s) information in a 'X' metadata. One 
      character only.

Keywords

• sam
• bam
• cram
• vcf

See also in Biostars

• https://www.biostars.org/p/322664

Creation Date

20180625

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/biostar/Biostar322664.java

Unit Tests

https://github.com/lindenb/jvarkit/tree/master/src/test/java/com/github/lindenb/jvarkit/tools/biostar/Biostar322664Test.java

Contribute

• Issue Tracker: http://github.com/lindenb/jvarkit/issues
• Source Code: http://github.com/lindenb/jvarkit

License

The project is licensed under the MIT license.

Citing

Should you cite biostar322664 ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

Input

• BAM : MUST be sorted using Picard SortSam (see https://github.com/samtools/hts-specs/issues/5 ). Update 20250313 : the output of ‘samtools collate’ should be ok too , as well as ‘samtools sort -n ‘(not tested)
• VCF : only SNP are considered. Genotypes are ignored (all ALT alleles are observed regardless of the sample/genotype )

##Example

$ java -jar picard.jar SortSam I=src/test/resources/S1.bam O=query.bam SO=queryname
$ java -jar dist/biostar322664.jar -V src/test/resources/S1.vcf.gz query.bam  


RF02_358_926_2:0:0_2:1:0_83	83	RF02	857	60	70M	=	358	-569	GACGTGAACTATATAATTAAAATGGACAGAAATCTGCCATCAACAGCTAGATATATAAGACCTAATTTAC	2222222222222222222222222222222222222222222222222222222222222222222222	RG:Z:S1	NM:i:3	AS:i:55	XS:i:0
RF02_362_917_2:0:0_2:1:0_6f	147	RF02	848	60	70M	=	362	-556	ATAAGGAATCACGTTAACTATATACTTAAAATGGACTGAAATCTGCCATCAACAGCTAGATATATAAGAC	2222222222222222222222222222222222222222222222222222222222222222222222	RG:Z:S1	NM:i:3	AS:i:55	XS:i:0
(...)

$ java -jar dist/biostar322664.jar -nm  -index -V src/test/resources/S1.vcf.gz src/test/resources/S1.bam 
(...)
RF02_827_1385_4:1:0_2:0:0_3f    163     RF02    827     60      70M     =       1316    559     ATCAATTACATTCCTGAAAGGATAAGGAATGAGGTTAACTATCTACTTAAAATGGACAGAAATCTGCCAA  2222222222222222222222222222222222222222222222222222222222222222222222  RG:Z:S1 NM:i:5  AS:i:53XS:i:0
RF02_827_1292_4:0:0_1:0:0_50    163     RF02    827     60      70M     =       1223    466     TTCAATTACATTCCTGCAAGGATAAGGAATGCCGTTAACTATATACTTAATAAGGACAGAAATCTGGCAT  2222222222222222222222222222222222222222222222222222222222222222222222  RG:Z:S1 NM:i:4  AS:i:51XS:i:0
(...)

This site is open source. Improve this page.