jvarkit

Biostar404363

Last commit

introduce artificial mutation SNV in bam

Usage

Usage: biostar404363 [options] Files
  Options:
    --bamcompression
      Compression Level.
      Default: 5
    --disable-nm
      Disable NM change. By default the value of NM is increasing to each 
      change. 
      Default: false
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
    --ignore-clip
      Ignore clipped section of the reads.
      Default: false
    -o, --output
      Output file. Optional . Default: stdout
  * -p, --position, --vcf
      VCF File containing the positions to change. if INFO/AF(allele 
      frequency) field is present, variant is inserted if rand()<= AF.
    -R, --reference
      For reading CRAM. Indexed fasta Reference file. This file must be 
      indexed with samtools faidx and with picard CreateSequenceDictionary
    --samoutputformat
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
    --version
      print version and exit

Keywords

See also in Biostars

Compilation

Requirements / Dependencies

Download and Compile

$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew biostar404363

The java jar file will be installed in the dist directory.

Creation Date

20191023

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/biostar/Biostar404363.java

Unit Tests

https://github.com/lindenb/jvarkit/tree/master/src/test/java/com/github/lindenb/jvarkit/tools/biostar/Biostar404363Test.java

Contribute

License

The project is licensed under the MIT license.

Citing

Should you cite biostar404363 ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

##Example

# look at the original bam at position 14:79838836
$ samtools tview -d T -p 14:79838836 src/test/resources/HG02260.transloc.chr9.14.bam | cut -c 1-20
     79838841  79838
NNNNNNNNNNNNNNNNNNNN
CATAGGAAAACTAAAGGCAA
cataggaaaactaaaggcaa
cataggaaaaCTAAAGGCAA
cataggaaaactaaaggcaa
CATAGGAAAACTAAAGGCAA
cataggaaaactaaaggcaa
CATAGGAAAACTAAAGGCAA
CATAGGAAAACTAAAGGCAA
CATAGGAAAACTAAAGGCAA
CATAGGAAAACTAAAGGCAA
CATAGGAAAACTAAAGGCAA
           taaaggcaa

# look at the VCF , we want to change 14:79838836 with 'A' with probability = 0.5
$ cat jeter.vcf
##fileformat=VCFv4.2
##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency among genotypes, for each ALT allele, in the same order as listed">
#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
14	79838836	.	N	A	.	.	AF=0.5

# apply biostar404363
$  java -jar dist/biostar404363.jar -o jeter.bam -p jeter.vcf src/test/resources/HG02260.transloc.chr9.14.bam

# index the sequence
$ samtools index jeter.bam

# view the result (half of the bases were replaced because AF=0.5 in the VCF)
$ samtools tview -d T -p 14:79838836 jeter.bam | cut -c 1-20
     79838841  79838
NNNNNNNNNNNNNNNNNNNN
MATAGGAAAACTAAAGGCAA
cataggaaaactaaaggcaa
aataggaaaaCTAAAGGCAA
cataggaaaactaaaggcaa
CATAGGAAAACTAAAGGCAA
aataggaaaactaaaggcaa
AATAGGAAAACTAAAGGCAA
AATAGGAAAACTAAAGGCAA
CATAGGAAAACTAAAGGCAA
CATAGGAAAACTAAAGGCAA
AATAGGAAAACTAAAGGCAA
           taaaggcaa