jvarkit

Biostar76892

Last commit

fix strand of two paired reads close but on the same strand.

Usage

Usage: biostar76892 [options] Files
  Options:
    --bamcompression
      Compression Level.
      Default: 5
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
    -d, --maxc
      distance beween two reads.A distance specified as a positive 
      integer.Comma are removed. The following suffixes are interpreted : 
      b,bp,k,kb,m,mb 
      Default: 30
    -osf, --osf
      only save pairs of reads which have been corrected by this program
      Default: false
    -o, --output
      Output file. Optional . Default: stdout
    --samoutputformat
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
    --version
      print version and exit

Keywords

See also in Biostars

Compilation

Requirements / Dependencies

Download and Compile

$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew biostar76892

The java jar file will be installed in the dist directory.

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/biostar/Biostar76892.java

Contribute

License

The project is licensed under the MIT license.

Citing

Should you cite biostar76892 ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

Example

Before fixing:

samtools view src.bam | grep "HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906"
HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906        177     3       1264832 37      101M    =       1264940 109     AGGTGGTGAAGCATGAGATGTAGGGAGAGCTGCTTTAAAACCCAGCACAAGGCTGGTT
GTACTGGCTCACACCTGTAATCCCAGGTCTTTGGGAGGCTGAG    """#""""#"""#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#""""""#""##"""""""#"#"   X0:i:1  X1:i:0  BD:
Z:ABBACCABBABAAABABAABAACBBABAA@AAABAABBAABB@AAAAAAABA@ABAA@BAA@@BAAAAAAAA@@BAAAABA@ABAAABAACBBACBAABAA       MD:Z:0C0C0C1C0C0G1G0T1T0T0G0C0C0T0T0C0T0G0T0A0C0A2T2C0A0T0G0
C1T0G0T0G2G0T0T0T0G1G0T1T1C0C0A0A0G0T0G0C0G0A1T0G1G0C0T1T0T2C0G0T0G0T0G1C1C0A1G1G0T1C0C1T0T2C0A0     RG:Z:idp63088   XG:i:0  BI:Z:ABBAEDCCCBCBBABABAAAA@CBBAB@A@@A@AAAAAAA
BA@@AAA@A@BA@@BAA@A@@@@BAA@A@@@A@@AAAAABA@@BAAABBACBBACBBABAA       AM:i:37 NM:i:75 SM:i:37 XM:i:1  XO:i:0  MQ:i:37 XT:A:U
HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906        113     3       1264940 37      101M    =       1264832 -109    GGTATCTCCATGCTCGAAGCCCTGACCTACTGTATTGCCCCGAAAGTCTTCCCTGCTG
TGGCTGCATCTTTTCCACGTGGATAATCTTGGTTCATCTCTAG    """##"""""""""""""""""""""""""#"""""""""""""""""""""""""""#"""""""""""""""#""""""""""""#""#""##"#"##"   X0:i:1  X1:i:0  BD:
Z:BBAABBBBAAABBBCBAABCBA@BAAAAAAABAAAAACCCBABAAAAAAACBAAAAABABA@AA@AAABBAAAAACB@BBAAAAAAAABBBAABBBBAAAA       MD:Z:0T0T1G0C0A1G0T1C0C0A1G0T0G0C0A0T0G0T0G0T0G2A0T4G0C0A0A0
T0G0T0G0C1G0G0T0G1C0A0G0T0T0G0C0A4C1A0T0G0C0G0T0G2G0G1C0G0T0G0A1C0G0T0G1G0C2T2T0C0G0T0G0T0A0T1       RG:Z:idp63088   XG:i:0  BI:Z:BABADDCCBBBCBBCBAABCBA@AABAAA@AAAAA@BBBB
BAAA@AA@AABA@@A@@A@BA@@A@AA@AAAAAAABB@BAAAAAAAA@CBAAABBBBAAAA       AM:i:37 NM:i:74 SM:i:37 XM:i:0  XO:i:0  MQ:i:37 XT:A:U

Fixing:

 java -jar dist/biostar76892.jar ONLYSAVEFIXED=true \
 	IN=src.bam \
 	OUT=fix.bam  \
 	VALIDATION_STRINGENCY=LENIENT

result

samtools view fix.bam | grep "HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906"
HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906        163     3       1264832 37      101M    =       1264940 109     AGGTGGTGAAGCATGAGATGTAGGGAGAGCTGCTTTAAAACCCAGCACAAGGCTGGTT
GTACTGGCTCACACCTGTAATCCCAGGTCTTTGGGAGGCTGAG    """#""""#"""#"""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""""#""""""#""##"""""""#"#"   X0:i:1  X1:i:0  BD:
Z:ABBACCABBABAAABABAABAACBBABAA@AAABAABBAABB@AAAAAAABA@ABAA@BAA@@BAAAAAAAA@@BAAAABA@ABAAABAACBBACBAABAA       MD:Z:0C0C0C1C0C0G1G0T1T0T0G0C0C0T0T0C0T0G0T0A0C0A2T2C0A0T0G0
C1T0G0T0G2G0T0T0T0G1G0T1T1C0C0A0A0G0T0G0C0G0A1T0G1G0C0T1T0T2C0G0T0G0T0G1C1C0A1G1G0T1C0C1T0T2C0A0     RG:Z:idp63088   XG:i:0  BI:Z:ABBAEDCCCBCBBABABAAAA@CBBAB@A@@A@AAAAAAA
BA@@AAA@A@BA@@BAA@A@@@@BAA@A@@@A@@AAAAABA@@BAAABBACBBACBBABAA       AM:i:37 NM:i:75 SM:i:37 XM:i:1  XO:i:0  MQ:i:37 XT:A:U  rv:i:1
HWI-1KL149:6:C0KTCACXX:5:2107:2283:35906        83      3       1264940 37      101M    =       1264832 -109    GGTATCTCCATGCTCGAAGCCCTGACCTACTGTATTGCCCCGAAAGTCTTCCCTGCTG
TGGCTGCATCTTTTCCACGTGGATAATCTTGGTTCATCTCTAG    """##"""""""""""""""""""""""""#"""""""""""""""""""""""""""#"""""""""""""""#""""""""""""#""#""##"#"##"   X0:i:1  X1:i:0  BD:
Z:BBAABBBBAAABBBCBAABCBA@BAAAAAAABAAAAACCCBABAAAAAAACBAAAAABABA@AA@AAABBAAAAACB@BBAAAAAAAABBBAABBBBAAAA       MD:Z:0T0T1G0C0A1G0T1C0C0A1G0T0G0C0A0T0G0T0G0T0G2A0T4G0C0A0A0
T0G0T0G0C1G0G0T0G1C0A0G0T0T0G0C0A4C1A0T0G0C0G0T0G2G0G1C0G0T0G0A1C0G0T0G1G0C2T2T0C0G0T0G0T0A0T1       RG:Z:idp63088   XG:i:0  BI:Z:BABADDCCBBBCBBCBAABCBA@AABAAA@AAAAA@BBBB
BAAA@AA@AABA@@A@@A@BA@@A@AA@AAAAAAABB@BAAAAAAAA@CBAAABBBBAAAA       AM:i:37 NM:i:74 SM:i:37 XM:i:0  XO:i:0  MQ:i:37 XT:A:U  rv:i:1