jvarkit

ConvertBamChromosomes

Convert the names of the chromosomes in a BAM file

Usage

This program is now part of the main jvarkit tool. See jvarkit for compiling.

Usage: java -jar dist/jvarkit.jar bamrenamechr  [options] Files

Usage: bamrenamechr [options] Files
  Options:
    --bamcompression
      Compression Level. 0: no compression. 9: max compression;
      Default: 5
    --dict
      Use this new dictionary A SAM Sequence dictionary source: it can be a 
      *.dict file, a fasta file indexed with 'picard CreateSequenceDictionary' 
      or 'samtools dict', or any hts file containing a dictionary (VCF, BAM, 
      CRAM, intervals...)
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
    -i, --ignore
      If the tool cannot convert a contig, skip the read
      Default: false
    -f, --mapping, -m
      load a custom name mapping. Format (chrom-source\tchrom-dest\n)+
    -o, --out
      Output file. Optional . Default: stdout
    -R, --reference
      For Reading CRAM. Indexed fasta Reference file. This file must be 
      indexed with samtools faidx and with picard/gatk 
      CreateSequenceDictionary or samtools dict
    --samoutputformat
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
    --version
      print version and exit

Keywords

• sam
• bam
• chromosome
• contig

See also in Biostars

• https://www.biostars.org/p/13462
• https://www.biostars.org/p/9479387

Creation Date

20131217

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/misc/ConvertBamChromosomes.java

Unit Tests

https://github.com/lindenb/jvarkit/tree/master/src/test/java/com/github/lindenb/jvarkit/tools/misc/ConvertBamChromosomesTest.java

Contribute

• Issue Tracker: http://github.com/lindenb/jvarkit/issues
• Source Code: http://github.com/lindenb/jvarkit

License

The project is licensed under the MIT license.

Citing

Should you cite bamrenamechr ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

Example

$ cat samtools-0.1.19/examples/toy.sam

@SQ	SN:ref	LN:45
@SQ	SN:ref2	LN:40
r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????

java -jar dist/bamrenamechr.jar \
   -f <(echo -e "ref\tCHROM1\nref2\tCHROM2")
   samtools-0.1.19/examples/toy.sam

@HD	VN:1.4	SO:unsorted
@SQ	SN:CHROM1	LN:45
@SQ	SN:CHROM2	LN:40
@PG	ID:0	PN:com.github.lindenb.jvarkit.tools.misc.ConvertBamChromosomes	VN:dfab75cb8c06e47e9989e59df62ec8f3242934c4	CL:-f /dev/fd/63 /commun/data/packages/samtools-0.1.19/examples/toy.sam
r001	163	CHROM1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
r002	0	CHROM1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
r003	0	CHROM1	9	30	5H6M	*	0	0	AGCTAA	*
r004	0	CHROM1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
r003	16	CHROM1	29	30	6H5M	*	0	0	TAGGC	*
r001	83	CHROM1	37	30	9M	=	7	-39	CAGCGCCAT	*
x1	0	CHROM2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	????????????????????
x2	0	CHROM2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????
x3	0	CHROM2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????
x4	0	CHROM2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????
x5	0	CHROM2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????
x6	0	CHROM2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????

See also

• https://github.com/lindenb/jvarkit/blob/master/src/main/resources/chromnames/g1kv37_to_hg19.tsv
• https://github.com/lindenb/jvarkit/blob/master/src/main/resources/chromnames/hg19_to_g1kv37.tsv
• [[VcfRenameChromosomes]]
• http://plindenbaum.blogspot.fr/2013/07/g1kv37-vs-hg19.html

history

• 20180612 : rewrote it, using a output Dict, handle the SA tag

This site is open source. Improve this page.