
Convert the names of the chromosomes in a BAM file
This program is now part of the main jvarkit tool. See jvarkit for compiling.
Usage: java -jar dist/jvarkit.jar bamrenamechr [options] Files
Usage: bamrenamechr [options] Files
Options:
--bamcompression
Compression Level. 0: no compression. 9: max compression;
Default: 5
--dict
Use this new dictionary A SAM Sequence dictionary source: it can be a
*.dict file, a fasta file indexed with 'picard CreateSequenceDictionary'
or 'samtools dict', or any hts file containing a dictionary (VCF, BAM,
CRAM, intervals...)
-h, --help
print help and exit
--helpFormat
What kind of help. One of [usage,markdown,xml].
-i, --ignore
If the tool cannot convert a contig, skip the read
Default: false
-f, --mapping, -m
load a custom name mapping. Format (chrom-source\tchrom-dest\n)+
-o, --out
Output file. Optional . Default: stdout
-R, --reference
For Reading CRAM. Indexed fasta Reference file. This file must be
indexed with samtools faidx and with picard/gatk
CreateSequenceDictionary or samtools dict
--samoutputformat
Sam output format.
Default: SAM
Possible Values: [BAM, SAM, CRAM]
--version
print version and exit
20131217
The project is licensed under the MIT license.
Should you cite bamrenamechr ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md
The current reference is:
http://dx.doi.org/10.6084/m9.figshare.1425030
Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030
$ cat samtools-0.1.19/examples/toy.sam
@SQ SN:ref LN:45
@SQ SN:ref2 LN:40
r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA *
r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
r003 16 ref 29 30 6H5M * 0 0 TAGGC *
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT *
x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ????????????????????
x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ?????????????????????
x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ??????????????????????????
x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ?????????????????????????
x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ????????????????????????
x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ???????????????????????
java -jar dist/bamrenamechr.jar \
-f <(echo -e "ref\tCHROM1\nref2\tCHROM2")
samtools-0.1.19/examples/toy.sam
@HD VN:1.4 SO:unsorted
@SQ SN:CHROM1 LN:45
@SQ SN:CHROM2 LN:40
@PG ID:0 PN:com.github.lindenb.jvarkit.tools.misc.ConvertBamChromosomes VN:dfab75cb8c06e47e9989e59df62ec8f3242934c4 CL:-f /dev/fd/63 /commun/data/packages/samtools-0.1.19/examples/toy.sam
r001 163 CHROM1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 CHROM1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 CHROM1 9 30 5H6M * 0 0 AGCTAA *
r004 0 CHROM1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
r003 16 CHROM1 29 30 6H5M * 0 0 TAGGC *
r001 83 CHROM1 37 30 9M = 7 -39 CAGCGCCAT *
x1 0 CHROM2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 CHROM2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x3 0 CHROM2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
x4 0 CHROM2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x5 0 CHROM2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????
x6 0 CHROM2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????