

Last commit

Convert the names of the chromosomes in a BAM file


Usage: bamrenamechr [options] Files
      Compression Level. 0: no compression. 9: max compression;
      Default: 5
      Use this new dictionary A SAM Sequence dictionary source: it can be a 
      *.dict file, a fasta file indexed with 'picard 
      CreateSequenceDictionary', or any hts file containing a dictionary (VCF, 
      BAM, CRAM, intervals...)
    -h, --help
      print help and exit
      What kind of help. One of [usage,markdown,xml].
    -i, --ignore
      If the tool cannot convert a contig, skip the read
      Default: false
    -f, --mapping, -m
      load a custom name mapping. Format (chrom-source\tchrom-dest\n)+
    -o, --out
      Output file. Optional . Default: stdout
    -R, --reference
      For Reading CRAM. Indexed fasta Reference file. This file must be 
      indexed with samtools faidx and with picard CreateSequenceDictionary
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
      print version and exit


See also in Biostars


Requirements / Dependencies

Download and Compile

$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew bamrenamechr

The java jar file will be installed in the dist directory.

Creation Date


Source code


Unit Tests




The project is licensed under the MIT license.


Should you cite bamrenamechr ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:


Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030


$ cat samtools-0.1.19/examples/toy.sam

@SQ	SN:ref	LN:45
@SQ	SN:ref2	LN:40
r001	163	ref	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
r002	0	ref	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
r003	0	ref	9	30	5H6M	*	0	0	AGCTAA	*
r004	0	ref	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
r003	16	ref	29	30	6H5M	*	0	0	TAGGC	*
r001	83	ref	37	30	9M	=	7	-39	CAGCGCCAT	*
x1	0	ref2	1	30	20M	*	0	0	aggttttataaaacaaataa	????????????????????
x2	0	ref2	2	30	21M	*	0	0	ggttttataaaacaaataatt	?????????????????????
x3	0	ref2	6	30	9M4I13M	*	0	0	ttataaaacAAATaattaagtctaca	??????????????????????????
x4	0	ref2	10	30	25M	*	0	0	CaaaTaattaagtctacagagcaac	?????????????????????????
x5	0	ref2	12	30	24M	*	0	0	aaTaattaagtctacagagcaact	????????????????????????
x6	0	ref2	14	30	23M	*	0	0	Taattaagtctacagagcaacta	???????????????????????

java -jar dist/bamrenamechr.jar \
   -f <(echo -e "ref\tCHROM1\nref2\tCHROM2")

@HD	VN:1.4	SO:unsorted
@PG	ID:0	PN:com.github.lindenb.jvarkit.tools.misc.ConvertBamChromosomes	VN:dfab75cb8c06e47e9989e59df62ec8f3242934c4	CL:-f /dev/fd/63 /commun/data/packages/samtools-0.1.19/examples/toy.sam
r001	163	CHROM1	7	30	8M4I4M1D3M	=	37	39	TTAGATAAAGAGGATACTG	*	XX:B:S,12561,2,20,112
r002	0	CHROM1	9	30	1S2I6M1P1I1P1I4M2I	*	0	0	AAAAGATAAGGGATAAA	*
r003	0	CHROM1	9	30	5H6M	*	0	0	AGCTAA	*
r004	0	CHROM1	16	30	6M14N1I5M	*	0	0	ATAGCTCTCAGC	*
r003	16	CHROM1	29	30	6H5M	*	0	0	TAGGC	*
r001	83	CHROM1	37	30	9M	=	7	-39	CAGCGCCAT	*
x1	0	CHROM2	1	30	20M	*	0	0	AGGTTTTATAAAACAAATAA	????????????????????
x2	0	CHROM2	2	30	21M	*	0	0	GGTTTTATAAAACAAATAATT	?????????????????????
x3	0	CHROM2	6	30	9M4I13M	*	0	0	TTATAAAACAAATAATTAAGTCTACA	??????????????????????????
x4	0	CHROM2	10	30	25M	*	0	0	CAAATAATTAAGTCTACAGAGCAAC	?????????????????????????
x5	0	CHROM2	12	30	24M	*	0	0	AATAATTAAGTCTACAGAGCAACT	????????????????????????
x6	0	CHROM2	14	30	23M	*	0	0	TAATTAAGTCTACAGAGCAACTA	???????????????????????

See also
