Fix Cigar String in SAM replacing ‘M’ by ‘X’ or ‘=’
Usage: samfixcigar [options] Files
Options:
--bamcompression
Compression Level.
Default: 5
-h, --help
print help and exit
--helpFormat
What kind of help. One of [usage,markdown,xml].
-o, --out
Output file. Optional . Default: stdout
-R, --reference
Indexed fasta Reference file. This file must be indexed with samtools
faidx and with picard CreateSequenceDictionary
--regions
Limit analysis to this interval. A source of intervals. The following
suffixes are recognized: vcf, vcf.gz bed, bed.gz, gtf, gff, gff.gz,
gtf.gz.Otherwise it could be an empty string (no interval) or a list of
plain interval separated by '[ \t\n;,]'
--samoutputformat
Sam output format.
Default: SAM
Possible Values: [BAM, SAM, CRAM]
--validation-stringency
SAM Reader Validation Stringency
Default: LENIENT
Possible Values: [STRICT, LENIENT, SILENT]
--version
print version and exit
${PATH}
. Setting JAVA_HOME is not enough : (e.g: https://github.com/lindenb/jvarkit/issues/23 )$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew samfixcigar
The java jar file will be installed in the dist
directory.
20131126
The project is licensed under the MIT license.
Should you cite samfixcigar ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md
The current reference is:
http://dx.doi.org/10.6084/m9.figshare.1425030
Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030
the input file
$ cat toy.sam
@SQ SN:ref LN:45
@SQ SN:ref2 LN:40
r001 163 ref 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 ref 9 30 5H6M * 0 0 AGCTAA *
r004 0 ref 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC *
r003 16 ref 29 30 6H5M * 0 0 TAGGC *
r001 83 ref 37 30 9M = 7 -39 CAGCGCCAT *
x1 0 ref2 1 30 20M * 0 0 aggttttataaaacaaataa ????????????????????
x2 0 ref2 2 30 21M * 0 0 ggttttataaaacaaataatt ?????????????????????
x3 0 ref2 6 30 9M4I13M * 0 0 ttataaaacAAATaattaagtctaca ??????????????????????????
x4 0 ref2 10 30 25M * 0 0 CaaaTaattaagtctacagagcaac ?????????????????????????
x5 0 ref2 12 30 24M * 0 0 aaTaattaagtctacagagcaact ????????????????????????
x6 0 ref2 14 30 23M * 0 0 Taattaagtctacagagcaacta ???????????????????????
processing with samfixcigar
$ java -jar dist/samfixcigar.jar \
-r samtools-0.1.19/examples/toy.fa \
samtools-0.1.19/examples/toy.sam
@HD VN:1.4 SO:unsorted
@SQ SN:ref LN:45
@SQ SN:ref2 LN:40
r001 163 ref 7 30 8=4I4=1D3= = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112
r002 0 ref 9 30 1S2I6=1P1I1P1I1X1=2X2I * 0 0 AAAAGATAAGGGATAAA *
r003 0 ref 9 30 2=1X3= * 0 0 AGCTAA *
r004 0 ref 16 30 6=14N1I5= * 0 0 ATAGCTCTCAGC *
r003 16 ref 29 30 5= * 0 0 TAGGC *
r001 83 ref 37 30 9= = 7 -39 CAGCGCCAT *
x1 0 ref2 1 30 16=1X3= * 0 0 AGGTTTTATAAAACAAATAA ????????????????????
x2 0 ref2 2 30 15=1X3=1X1= * 0 0 GGTTTTATAAAACAAATAATT ?????????????????????
x3 0 ref2 6 30 9=4I13= * 0 0 TTATAAAACAAATAATTAAGTCTACA ??????????????????????????
x4 0 ref2 10 30 1X3=1X20= * 0 0 CAAATAATTAAGTCTACAGAGCAAC ?????????????????????????
x5 0 ref2 12 30 2=1X21= * 0 0 AATAATTAAGTCTACAGAGCAACT ????????????????????????
x6 0 ref2 14 30 1X22= * 0 0 TAATTAAGTCTACAGAGCAACTA ???????????????????????
This tool was cited in