Write text in a bam. Mostly for fun…
This program is now part of the main jvarkit
tool. See jvarkit for compiling.
Usage: java -jar dist/jvarkit.jar texbam [options] Files
Usage: texbam [options] Files
Options:
--bamcompression
Compression Level. 0: no compression. 9: max compression;
Default: 5
-h, --help
print help and exit
--helpFormat
What kind of help. One of [usage,markdown,xml].
-o, --output
Output file. Optional . Default: stdout
-p, --pos
use this position instead of a random one. Syntax: CHROM:POS
Default: <empty string>
* -R, --reference
Indexed fasta Reference file. This file must be indexed with samtools
faidx and with picard/gatk CreateSequenceDictionary or samtools dict
--samoutputformat
Sam output format.
Default: SAM
Possible Values: [BAM, SAM, CRAM]
--snp
use SNV instead of deletion
Default: false
--version
print version and exit
20220708
The project is licensed under the MIT license.
Should you cite texbam ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md
The current reference is:
http://dx.doi.org/10.6084/m9.figshare.1425030
Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030
$ ./gradlew textbam && \
java -jar dist/textbam.jar -R src/test/resources/rotavirus_rf.fa -p 'RF01:100' "Hello world" | samtools view -O BAM -o jeter.bam && \
samtools index jeter.bam && \
samtools tview ~/jeter.bam src/test/resources/rotavirus_rf.fa
samtools tview ~/jeter.bam src/test/resources/rotavirus_rf.fa -d T -p RF01:100
101 111 121 131 141 151 161
TATTCTTCCAATAGTGAATTAGAGAATAGATGTATTGAATTTCATTCTAAATGCTTAGAAAACTCAAAGAATGGACTATC
................................................................................
................................................................................
...............................................................................
..............*....*......******......*...........*............*****..........
.............*....*......*...........*...........*............*....*.........
............*....*......*...........*...........*...........*.....*.........
...........******......****........*...........*...........*.....*.........
..........*....*......*...........*...........*...........*.....*.........
.........*....*......*...........*...........*...........*....*..........
........*....*......*...........*...........*............**..*..........
.......*....*......******......******......******.........**...........
......................................................................
.....................................................................