jvarkit

VcfToBam

Last commit

vcf to bam

Usage

Usage: vcf2bam [options] Files
  Options:
    --bamcompression
      Compression Level.
      Default: 5
    --fragmentsize
      fragment size
      Default: 600
    -h, --help
      print help and exit
    --helpFormat
      What kind of help. One of [usage,markdown,xml].
    -o, --output
      Output file. Optional . Default: stdout
    --readsize
      read size
      Default: 100
  * -r, -R, --reference
      Indexed fasta Reference file. This file must be indexed with samtools 
      faidx and with picard CreateSequenceDictionary
    --samoutputformat
      Sam output format.
      Default: SAM
      Possible Values: [BAM, SAM, CRAM]
    --version
      print version and exit

Keywords

Compilation

Requirements / Dependencies

Download and Compile

$ git clone "https://github.com/lindenb/jvarkit.git"
$ cd jvarkit
$ ./gradlew vcf2bam

The java jar file will be installed in the dist directory.

Source code

https://github.com/lindenb/jvarkit/tree/master/src/main/java/com/github/lindenb/jvarkit/tools/misc/VcfToBam.java

Contribute

License

The project is licensed under the MIT license.

Citing

Should you cite vcf2bam ? https://github.com/mr-c/shouldacite/blob/master/should-I-cite-this-software.md

The current reference is:

http://dx.doi.org/10.6084/m9.figshare.1425030

Lindenbaum, Pierre (2015): JVarkit: java-based utilities for Bioinformatics. figshare. http://dx.doi.org/10.6084/m9.figshare.1425030

##Example

$ java -jar dist-1.139/vcf2bam.jar -R ref.fa  samtools.vcf.gz 2> /dev/null | grep -v "100="



@HD	VN:1.5	SO:unsorted
@SQ	SN:seg1	LN:5101
@SQ	SN:seg2	LN:4000
@RG	ID:NA12878	SM:NA12878	LB:illumina	DS:NA12878
@RG	ID:NA12891	SM:NA12891	LB:illumina	DS:NA12891
@RG	ID:NA12892	SM:NA12892	LB:illumina	DS:NA12892
@CO	Generated with -R /home/lindenb/src/ngsxml/test/ref/ref.fa /home/lindenb/src/ngsxml/OUT/Projects/Proj1/VCF/samtools/Proj1.samtools.vcf.gz
0000003609	83	seg1	1449	60	99=1X	=	949	-500	TGCTTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12891	NM:i:1
0000003610	147	seg1	1449	60	99=1X	=	949	-500	TGCTTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12891	NM:i:1
0000003611	147	seg1	1449	60	99=1X	=	949	-500	TGCTTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12892	NM:i:1
0000003612	83	seg1	1449	60	99=1X	=	949	-500	TGCTTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12892	NM:i:1
0000003615	83	seg1	1450	60	98=1X1=	=	950	-500	GCTTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12891	NM:i:1
0000003616	147	seg1	1450	60	98=1X1=	=	950	-500	GCTTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12891	NM:i:1
0000003617	147	seg1	1450	60	98=1X1=	=	950	-500	GCTTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12892	NM:i:1
0000003627	147	seg1	1452	60	96=1X3=	=	952	-500	TTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCTCT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12891	NM:i:1
0000003629	147	seg1	1452	60	96=1X3=	=	952	-500	TTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCTCT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12892	NM:i:1
0000003630	147	seg1	1452	60	96=1X3=	=	952	-500	TTTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCTCT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12892	NM:i:1
0000003633	147	seg1	1453	60	95=1X4=	=	953	-500	TTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCTCTC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12891	NM:i:1
0000003635	83	seg1	1453	60	95=1X4=	=	953	-500	TTAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCTCTC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12892	NM:i:1
0000003640	147	seg1	1454	60	94=1X5=	=	954	-500	TAGAAAGCATTCCAAAATCTCTTACCAGTTTTATCTCCTATGAAAGTCCTTCACACTTTCTCTCATTTAAACTTTATTGCATTTTCCTCACTTTCTCTCA	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	RG:Z:NA12891	NM:i:1